With the White Rabbit down the hole. The spread of a coastal DNA

Hans Faber

Jul 22, 2020

R1b/Hg1/Eu18; R-M213; R-M9; R1b-M45; R-M207; R-M173; R-M343; R-L278; R-L754; R-L389/R1b1a1; R-M415; R-P297/R1b1a1a; R-M269/R1b1a1a2; R-M520; R-L23; R-M412; R-L11; R-S21/U106/M405/R1b1a1a1a2a1a1... Knock Knock… Wake up Neo… Follow the White Rabbit…|

These serial numbers, chronologically arranged, represent groups and subgroups of people who genetically share one common ancestor. Pulling these protein strands is like going down the rabbit hole. It leads you from the Old Stone Age to the Middle Bronze Age. From 20,000-15,000 years ago to 4,500-4,000 years ago. From the shores of the brackish Caspian Sea to the southern shores of the murky North Sea. It is at these cold, muddy waters where the genetic common ancestor of the Germanic peoples once lived. Amazingly, the highest concentration of this specific DNA today can be found precisely in the area which the Frisia Coast Trail covers. Some even speak of the ‘Frisian branch‘ (Eupedia.com 2011).

So, the truly irrelevant question arises:

Is Frisia the cradle of the Germanic peoples?

This blog post is about genetics. Developments in this research field go in a high pace. Nearly impossible to keep track with. We, therefore, repeat a warning we found on the web concerning genetics: “Everything presented in this document is wrong. The question is: how wrong?” (MacDonald 2015).

Trying to understand the language geneticists use is like decoding The Matrix. For this reason, people easily risk copying existing texts on the web. We recall Dawkins (1976) that this is exactly how memes behave: an idea or a (cultural) concept replicating itself through the minds of people. Like the present one (2020), which says that the G5 network is responsible for COVID-19. Before you know it, everybody starts believing it, identical to how our selfish genes operate. In today’s language of policymakers and news reporters, memeing is called framing. Yeah, you got the idea by now.

Immediate cause for us to take a closer look at the so-called 'Frisian branch' DNA was the recent blog post ‘Genetic Maps of Europe’ from the blog The Dockyards this summer (2020). That blog post, however, turned out to be a replication, indeed a meme, of the information available on the community platform Eupedia.com, which has a separate section on the genetics of Europe. Sadly, there are no useful specific references at Eupedia.com either concerning the 'Frisian branch', albeit their visual presentation is quite impressive. You are almost convinced without reading a single syllable.

So, we descended further down the hole in search of sources this Frisian branch theory is based upon. Browsing for ‘Germanic DNA‘, we found mostly more or less replicating texts saying this genetic group was (proto-)Germanic, that it originates from the shores of the Netherlands and northwest Germany, and that it is about 2,500 years old. Indeed, a meme or frame. But what is the veracity? Or better, what is least wrong?

We continued following the White Rabbit, trying to leave the countless web parrots behind us, and with great awe and reverence, we, humble coastal hikers and Frisian bastards, explored articles of genetic science. Below is what we found. When, however, you are the type who prefers to remain in blissful ignorance, this is the moment to stop reading this blog post and swallow the blue pill. Actually, it is often the better choice in life, also known as 'social bubble'.

Welcome in Wonderland

Our condolences, you continued reading.

Before we start, we must explain two or three things about genetics. Do not worry, we limited it to the bare minimum, to avoid reading this blog post feels like a lecture, and because of our extreme limited understanding of this complex science as well.

YX and XX

DNA research concerning the origin of humans can be approached via the male chromosomes or via the female chromosomes. The first is the study of the Y chromosome (yDNA). This is DNA passed on from father to son via the Y chromosome. The second is mitochondrial DNA (mtDNA), which is passed down from mother to her child(ren) via the two X chromosomes. There is a third variant, namely autosomal DNA (atDNA), which concerns the twenty-two non-sex-related chromosomes. We leave atDNA for what it is. Most genetic research focusing on the origins of peoples concentrates on the Y chromosome because it is especially useful for reconstructing population histories (Altena 2019).

Comparing yDNA and mtDNA can give you interesting insights into the (mis)behaviour of males. For example, the male yDNA of African Americans in the United States is overall thirty-three percent European. When you look at the female mtDNA of the same African Americans, only about six percent is European. A Snow White-like mirror, this time genetically confronting us with the behaviour of European white men during slavery (Shaw 2009).

Comparable male behaviour might have taken place during the colonization of England by the Anglo-Saxons, considering the massive contribution to the English gene pool. Indeed, early Anglo-Saxon society might have known apartheid-like structures in which the native Romano-Celtic population was restricted in reproduction (Thomas 2006). The legendary Frisian brothers Hengist and Horsa even stood at the basis of this aggressive form of immigration originating from the south-eastern coast of the North Sea.

Another example of colonial manly behaviour concerns the population of modern Iceland. Male yDNA is predominantly Nordic, while female mtDNA is predominantly Gaelic (O’Sullivan 2018). The Icelandic sagas recount women from Ireland and Scotland raided by Norwegians, dubbed as Vikings, which are thus genetically confirmed. Unless, of course, Irish and Scottish women were attracted by the beauty of the Icelandic landscape and travelled voluntarily to the icy island and took its uncivilized, strange-speaking Norsemen for granted. We consider this a less likely scenario. Similar to the DNA of Iceland is the DNA of Scandinavian men and Celtic women on the Faroe Islands (Gershon 2021). Read also our blog post Latið meg ei á Frísaland fordervast! And the murder of a bishop to read more about this grab-a-woman phenomenon, only this time done by Frisian pirates operating in the northern seas.

In the period 1530 and 1780, about 1.25 million Europeans were enslaved by Muslims of northern Africa, the so-called Barbary Coast. We are not aware that much research has been done into the DNA footprint of these so-called Christian slaves in northern Africa, but possibly less visible than the examples of the African Americans and Anglo-Saxons, because Muslims prevented Christian male slaves from reproducing themselves. Vigorously even. To what extent female white slaves bore children with Muslim offspring is unknown. However, around the year 1700, citizens of the city of Algiers were known for their white complexion (Davis 2003).

Yes, once you are down the Rabbit Hole, there is little Little Miss Sunshine left. Sorry to have popped the bubble.

Haplogroups

A central entity you come across in genetics is haplogroups, sub-haplogroups, and haplotypes. A haplogroup is a group of haplotypes. Haplotypes are organisms, including humans, that share a common ancestor with a specific chromosomal mutation. Subgroups of a haplogroup are often named clades, subclades, or, even more brainy, single nucleotide polymorphisms (SNPs, pronounced as "snips"). The term ‘genetic marker’ or short ‘marker’ is thrown in for good measure as well. Since all these genetic (sub)groups are one way or another a subset of an older DNA lineage, or at least constitute a common genetic variation, we keep it simple and stick to the term haplogroup in this blog post. It probably misses all kinds of crucial subtleties, but it does give you a feeling that you understand some things.

Another difficulty we experienced when diving into the world of genetics is the inconsistent naming of haplogroups. You might have three, four, sometimes five different names for a single haplogroup. Besides that, the names themselves are always a confusing combination of letters and numbers. The cause of this wild growth of names is commerce. Private companies are very active in the genetic genealogy business and have their own naming conventions. Science is, predictably and vainly, reluctant to adopt names invented by the ruffians of the firms in the private sector. Nothing good can come from commerce, of course.

Try not to resist it. It is too late for the blue pill anyway.

Sign the Times

A last remark concerns the use of time scales and the determination of the age of haplogroups. Geneticists, like geologists, often use the abbreviation BP (before present), rather than BC (before Christ) and AD (Anno Domini), as most archaeologists and historians do, or rather than BCE (before the common era) and CE (common era), which is used by scholars who want to be inclusive c.q. stay religiously and politically correct. The BP time scale takes the year 1950 as ‘Present’. As to why? It has something to do with radiocarbon dating. Do not bother. Plus, you have scholars who use the abbreviation ya (years ago) with k as thousand, m as million, and b for billion. So, 9kya is 9,000 years ago. Lastly, you have those simple souls of science who only use, for example, ‘7,500 years ago’. No fancy abbreviations or anything. Just check the date the article was published in, for example, the science journal Nature, and you know the age of the haplogroup. Or should you take the date when the research was carried out a few years before publication?

Anyway, it resembles a situation comparable to the many different electric plugs, connectors, and sockets in the world, without anyone having an adapter. We decided to stick with BC and AD, familiar to everyone, and since we are based in Europe anyway.

Concerning the dating of Y-chromosome lineages, based on mutation rates, this, in general, is notoriously difficult and thus controversial within science. Age estimates can differ by a whopping factor of three (Busby 2011). Again, the question is: how wrong?

Genetic Europe

Where in the history of genes should we start our blog post? At the cradle of mankind in Africa, with Lucy? Or maybe a bit further down the road?

We opted to start where the genetic tree splits and haplogroup R1b emerged. Fifty percent of men in Europe, namely, carry the genetic combination of the R haplogroup. It emerged in West Asia based on three evident genetic splits that occurred outside Europe, probably between 23,500 and 10,500 BC. Not a very precise estimation, indeed, as warned above. The two main branches of R1b are: the R-V88, a group that migrated to Central Africa, and the R-M269, a group that migrated to Europe.

AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GAAA/GAAA/GAAA/GAAAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTG

This is the R-M269 DNA sequence, not somebody in agony.

During the Mesolithic Age, also called the Middle Stone Age, between around 9,000 to 5,000 BC – interestingly enough, there is not a real consistent time period for the Mesolithic, either – people living in Europe were hunter-gatherers who had started to settle and who built huts. Before that, during the Palaeolithic Age or Old Stone Age, people basically wandered around in small groups and sought shelter in caves. Farming was still unknown to these captain cavemen during the Mesolithic Age.

Around 8,000 BC, agricultural techniques, including cattle herding, developed in the Fertile Crescent in southwest Asia, i.e., the combined regions of Assyria, Mesopotamia, the Nile Delta, and Phoenicia. These farmers also started to migrate – what is it with humans, always on the move? – and took with them their new technology. Around 5,500 BC, they spread into Europe and initiated a dramatic growth of the European population (Busby 2011). It marked the end of the Mesolithic Age and the beginning of the Neolithic Age, also called the New Stone Age. Indeed, "Wake up Neo(lithic)...," and Bedrock cities started to pop up like mushrooms.

Drinking cattle milk – Domestication of wild aurochs started around 7,000 BC, in the vicinities of both modern countries Pakistan and Turkey (McTavish et al 2012), and milk fats have been found in Turkey near the Sea of Marmara in the same period. Around 5,000 BC, domestic cattle shows up in the area of the southern coast of the North Sea.

Drinking milk requires a genetic constitution of being lactose tolerant. Most people on the planet are, in fact, lactose intolerant. When the genetic mutation of tolerance appeared, these people had an advantage. This genetic mutation appears around the same time when nomadic pastoralism appeared, i.e., moving from one place to another with your cattle and sheep for new pastures (Pront & McMarron 2023).

Farmer communities entered Europe from the east via two main routes: the Central European route via Hungary and Germany, and the southern Mediterranean route via Turkey and Greece. The Neolithic Age lasted from around 5,000 to 2,000 BC, when the Bronze Age began.

The first farmers and cattle herders from southwest Asia reached Europe via the Mediterranean route, with western Anatolia in Turkey as a stepping stone. It was between circa 7,000 and 6,500 BC that the first farmers based themselves in western Anatolia, northern Greece, on the Peloponnesus, and on the island of Crete. By around 6,000 BC, they had reached the south of Italy. From there, they migrated to Mediterranean France and Spain. Genetic research also proved that agriculture was not the migration of a concept, but the migration of people carrying this knowledge. This migration flow is generally identified with the spread of the Indo-European language family, and western Anatolia is considered its homeland. This southern Mediterranean route, with only slightly different time scales, is confirmed in different genetic research (Myres 2011, Bouckaert 2012, Hofmanová 2016).

The second, younger flow of farmers came along the central European route, via Hungary through Germany to France, and took place around 5,500 BC. This group reached the British Isles and Scandinavia around 4,000 to 3,000 BC. These genetic movements resemble the archaeological findings on how the Linearbandkeramik (LBK) culture, also called Linear Band Ware, spread over Europe, following the great rivers Danube, Elbe, and Rhine.

So, from roughly 7,000 BC, the transition of Europe from hunter-gatherers to farmers started in the southeast of Europe and was accomplished by around 3,000 BC, when it had reached the western fringes of the Continent (Gkiasta 2003). These new settlers were genetically distinct from the existing population and were related to populations in the Near East (Bramanti 2009, Balaresque 2010). Not much merci on the hunter-gatherers.

It is haplogroup R-M269 that coincides with the arrival and spread of agriculture across the European Continent. Also, R-M269 is associated with the spread of the Indo-European languages. Today, more than 100 million European men carry Y chromosomes belonging to R-M269. Furthermore, haplogroup R-M412, also named S167 or L51, can be considered the founder of western Europe. More than seventy percent of all West European men carry this mutation. The frequencies of R-M412 are highest in the west and decrease eastward, while it is absent in the Near East, Caucasus, and West Asia (Myres 2011).

The immigration flows of the R-M269 peoples did not wipe out the native European hunter-gatherers entirely. Au contraire, research revealed a complex process of admixture. A study of the human remains of the so-called Kostenki 14 body, dated 34,000 BC and found in Russia, shows that much of its genes (C-M130) can still be traced in western Europeans, with the highest resemblance in northern Europe, especially the Baltics. This research also demonstrates that the European hunter-gatherers split from the East Asian gene pool around 34,000 BC already. The so-called K14 DNA also contains relatively high Neanderthal ancestry, namely 2.4 percent (Seguin-Orlando 2014). Of course, features of northern Europeans still show their admixture :-) Other research also confirmed that Bronze Age populations in central and northern Europe are composed of an admixture of new Neolithic farmers and native Mesolithic hunter-gatherers (Allentoft 2015).

AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GAAAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTG

This is the R-S21 DNA sequence, not someone choking. For your convenience we have marked in bold the difference with the R-M269 sequence.

In 2005, R-S21 was identified for the first time by Dr. Faux of the company EthnoAncestry, Ltd. This haplogroup became one of the distinctive genetic groups in north-western Europe. The R-S21 has different names, by the way. First known as R1b1b2a, and later as R1b1b2a1a. It is also known as R-U106 and R-M405. Out of all these names, we use R-S21, without having a particular criterion to choose this name other than that it is a relatively short and practical notation.

The European haplogroup R-269 can be subdivided into the north-western haplogroup R-S21, the western haplogroup R-S145, also known as R-L21, and the southern haplogroup R-S28, also known as R-U152. R-S21 frequencies score highest in the Netherlands with almost eighty percent and fade out to the east and south, with respectively over fifty percent in the Czech Republic and only about twenty-five percent left in Italy. Hence, R-S21 is considered the ‘north-western’ or ‘Germanic’ haplogroup (Lucotte 2015). That R-S21 frequencies are highest in the Netherlands was established already before, soon after its discovery in 2005 (Myres 2007). More specifically, this means that the Netherlands is the most obvious location for the common ancestor of the Germanic peoples. Moreover, other genetic research showed that within the Netherlands, the province of Friesland had the highest frequencies of R-S21 (Busby 2011). That is way the term 'Frisian branch' is used form time to time.

Quite recent research (Altena 2019) investigated the most common yDNA haplogroups within the Netherlands, namely haplogroup I (twenty-eight percent) and R (sixty-two percent). Within R, the most common haplogroups are R-L48 (fifteen percent), R-S21 (fourteen percent), and R-S116 (nine percent). This research showed highest frequencies of R-S21 along the coastal zone, but this time with the province of Zeeland being the highest. However, all gradient differences were marginal. When the genetic dataset of the region of Flanders in Belgium was combined with that of the Netherlands, no significant gradient concerning R-S21 was observed anymore. Thus, this study of Altena does not present a deeper insight into the local spread of the ‘Germanic’ chromosome R-S21 within the Netherlands, additional to the studies mentioned of Lucotte and Busby. Within the wider region including Germany, however, the results of Altena do confirm the southeast-northwest axis of haplogroup R-S21, with increasing frequencies towards the northwest, i.e., towards the Netherlands.

Furthermore, in general, male yDNA shows clear genetic geographic patterns in the Netherlands, whilst female mtDNA does not show any population substructures (Chaitanya 2015). This could mean different demographic patterns between men and women, yet to be explained.

We could not find firm results on dating the age of R-S21, but it spread over north-western Europe during the Neolithic Age (New Stone Age), between circa 5,000 and 2,000 BC (Lucotte 2015). So, it spread from the shores of the Netherlands to southern Scandinavia, Belgium, northern France, and into Germany. Others date R1b-S21 between 3,400 and 2,500 BC (McNeill), or around 3,000 BC (FamilyTreeDNA), or between 2,600 and 500 BC (McDonald 2015). To what extent the three latter datings are, in fact, repetitive memes, we do not dare to say. No scientific substantiation could be found on these, anyhow.

Being an R-S21 mutant

Maybe after reading this blog post you decide to test your own DNA at one of those family tree companies to see if you are 'true' Germanic. But you may ask yourself, what does it mean? Should we start chasing rabbits? How will this knowledge change my life?

It solely means you have a common ancestor together with all other people sharing this tiny piece of DNA strand. Being part of the peoples who live in north-western Europe, the Germanic countries. This common ancestor was born, perhaps 5,000 years ago, in the area that is now the Netherlands. In a habitat that was a confluence of big rivers, with extensive marshlands and peatlands, bordering the sea. Most probably, this ancestor lived near the coast, and very well in what is now the province of Friesland. From there, his offspring spread over the Germanic countries of today, particularly further to the east of the River Rhine and to southern Scandinavia. These tribes were first called Germanic by the Romans, two thousand years ago. A generic classification given by them, the Romans, without too much anthropological or genetic substantiation. Just as well, these people have been named Celts. For more answers to the question Germanic or Celtic? read our blog post Barbarians riding to the Capital to claim rights on farmland.

In this area, also the oldest water vessel of the world has been found, namely the Pesse Canoe. It old age is between 8040 and 7510 BC, so possibly even predating the oldest Germanic man. For more, read our blog post Oldest Vessel of the World – the Pesse Canoe.

Later, during Late Antiquity and the Early Middle Ages, migration movements occurred from southern Scandinavia back to the south and southwest again, and from the southern coast of the North Sea into Britain. The latter explains why, in fact, modern English and Frisians are genetically indistinguishable (Weale 2002). Check also our blog post Have a Frisians Cocktail! A rich composition to learn more about the Anglo-Saxon-Frisian connection. During the late Early Middle Ages, another wave of Germanic immigrants to the British Isles occurred. These were called Norsemen or Northmen. Their genetic footprint is that about six percent of the UK population carries "Viking DNA" (Margaryan 2020).

Furthermore, the migrating offspring of the so-called ‘Frisian godfather mutant’, of course, admixed with other genetic, ‘original’ populations.

In other words, the DNA of what we call the Germanic peoples is much richer than R-S21 and very complicated. Moreover, we do not even know if this particular Germanic haplogroup is responsible for any features. If you think it might be a white complexion, eh’nt! Wrong. Probably, the early farmers migrating from the Near East already had this phenotype already. To finish it off; blue eyes were already present among the hunter-gatherers in Europe, long before the R-S21 mutant came into play (Lalueza-Fox 2012, Allentoft 2015).

Look at Fred Flintstone, his family and his neighbours, and judge for yourself how accurate their image is.

We arrived at the end of the Rabbit Hole.

Conclusion, we (re)confirmed the location of the so-called Frisian godfather of the 'Germanic' gene pool. It is, as stated, exactly where most of the Frisia Coast Trail runs today!

What we think is the most interesting part, is that genetic research proved – for the time being – that Proto-Germanic peoples originate on the southern coast of the North Sea and spread from there into Europe. Thus, from now on Frisians finally have something to boast of about, and like their inseparable sheep can bleat they are the real daddies of Vikings, Saxon, Frankish, and Anglo-Saxon warriors. But before they go off singing and shouting "Who's your daddy?", what does this specific piece of DNA mean in terms of how we look like and how we (mis)behave(d), etc.? Well – it does not mean squat. At least, nothing concrete, as far as we could find. Yes, another bubble popped.

We hope that is not too much of a disappointment for you that we end this blog post like this. It is like what Socrates said: “Ένα ξέρω, ότι δεν ξέρω" (I know that I know nothing). Who knows what more knowledge genetic research will bring in the near future. A lot we expect!

...|

Note 1 – In our blog post The Giants of Twilight Land. Creatures of the Rim we described the happy, long lugs of the north of the Netherlands. In fact, the tallest people that have ever lived on the earth. Has it to do with their genes?

Note – 2 More Lebesraum for Germanic genes

During the Second World War, the Nazis carried out a sick scheme in Europe. In the Netherlands it was named, at first, Culano (i.e. Commission for Sending Farmers to Eastern Europe) but later carried out by the NSB (i.e. National-Socialist Movement) itself under the very original banner of the NOC (i.e. Dutch East Company).

Soon after Hitler had conquered eastern Europe, the Nazis tried to mobilize people from the Germanic countries to colonize these new lands, especially the Baltics, Belarus, and Ukraine. A way to replace the Slavic race by the Germanic one, and creating more Lebesraum. The "Drang nach Osten" and the ideology of Umvolkung of the Slavic people. In most European countries there were no volunteers, but in the Netherlands, however, there were quite a few. The Dutch were “blutmässig unerhört wertvolle Kräfte” according to Heinrich Himmler.

From 1941, the first Dutch volunteers left for the east. Frisians featured prominently in this scheme, both in organizing and volunteering. The Frisian Director General of Agriculture, Geert Ruiter, a member of the SS, was one of the driving forces of the Dutch government. Although the farming sector in the Netherlands was in decline, most volunteers gave as their reason their membership in the NSB.

The whole scheme was an utter disaster, as was everything that came out of the brains of the Nazis. The Nazis showed their frustration that the Dutch pioneers soon mingled with the Slavic people, including having sexual affairs with the local non-Germanic women. Furthermore, many Dutch farmers transformed into smugglers and fences. From 1944 onward, the so-called blutmässig wertvolle Kräfte hastily returned, with their scarred genes, to the Netherlands and the province of Friesland, once Russia was in the counterattack all the way to Berlin.

Suggested music

Jefferson Airplane, White Rabbit (1967)

Lamont Dozier, Going To My Roots (1977)

Kid Creole and the Coconuts, Who's Your Daddy Now? (2001)

Frisia Coast Trail.com

The 1,000 mile coastal hike for people with fear of heights
and interest in 2,500 years of living on the sharp edge of land and sea